Logo weiterlesen.de
Das geheime Leben im Menschen

Itai Yanai und Martin Lercher

DAS GEHEIME LEBEN
IM MENSCHEN

EIN FASZINIERENDER BLICK
AUF DIE GESELLSCHAFT
UNSERER GENE

Übersetzung aus dem Englischen
von Martin Lercher

Inhalt

  1. Vorwort
  2. Prolog
  3. 1 In acht einfachen Schritten zum Krebs
    1. Eine Erkrankung des Genoms
    2. Der Wunschzettel einer zukünftigen Krebszelle
    3. Ein abtrünniges Genom
    4. Ein Schritt vorwärts, ein Schritt zurück
  4. 2 Wie unsere Feinde uns formen
    1. Die Gengesellschaft
    2. Ein Bakterium vergisst nie
    3. Ein Fahndungsfoto-Zufallsgenerator
    4. Was würde Darwin tun?
    5. Doppelagenten und Babygiraffen
    6. Lamarcks Milch
  5. 3 Sex – wer will denn so was?
    1. Die Vorteile von Sex (jenseits des Offensichtlichen)
    2. Sex macht gleich
    3. Hoher Einsatz – große Versuchung
    4. Es geht hier nicht um uns
    5. Der Kampf der Geschlechter:
      Embryonen als Schlachtfelder
  6. 4 Das Clinton-Paradoxon
    1. Diesseits und jenseits von Afrika
    2. Evolution – in Farbe und mit Geschmack
    3. Gene im Glück
    4. Afrikas genomisches Füllhorn
    5. Tückische Gene
  7. 5 Promiskuitive Gene in komplexer Gesellschaft
    1. Ein genialer Erbsenzähler
    2. Mitgefangen – mitgehangen
    3. Der modernde Kahn des Theseus
    4. Promiskuitive Teams bei Bakterien
    5. Perfekte Arzneien
  8. 6 Von Menschenaffen und Affenmenschen
    1. Genome im Fluss
    2. Schlüssel, die in Schlössern klemmen
    3. Eine berührende Familienzusammenführung
    4. Besser als Sex
    5. Make Love, Not War
  9. 7 Es kommt drauf an,
    was man damit macht
    1. Sprich dich aus
    2. Big Brain Theory
    3. Gen-Logik
    4. Chefetagen und hoffnungsfrohe Monster
  10. 8 Nachahmung, Diebstahl und
    der Ursprung aller Erfindung
    1. Auge um Auge
    2. Das bleibt in der Familie
    3. Die Legosteine der Gengesellschaft
    4. Das Import/Export-Gewerbe
  11. 9 Eine Schattenexistenz
    1. Die Geburt eines Reiches
    2. Wenn du sie nicht besiegen kannst,
      schließ dich ihnen an
    3. Lang leben die Prokaryoten!
  12. 10 Die Trittbrettfahrer des Lebens
    1. Erfolg auf ganzer Linie
    2. Die Zwickel von San Marco
    3. Der Erzfeind des Lebens
    4. Biologie für Anfänger
  13. Epilog
  14. Literaturhinweise
  15. Dank
  16. Register

VORWORT

»Es ist nicht die Wohltätigkeit eines Metzgers, Brauers oder Bäckers, von der unser tägliches Essen abhängt, sondern einzig deren Rücksichtnahme auf ihre eigenen Interessen.«

Adam Smith

Parallel zu unserer menschlichen Gesellschaft, tief im Verborgenen, existiert eine noch viel ältere Gesellschaft: die Gesellschaft der Gene. Die Mitglieder dieser Gengesellschaft gestalten unseren Körper und Geist, unsere Instinkte und Sehnsüchte. Die Instruktionen der Gengesellschaft haben die Menschheit bis an den Anfang des dritten Jahrtausends geführt; in welchem Ausmaß wir sie auch über unsere Zukunft bestimmen lassen werden, ist noch ungewiss. Wie kontrollieren uns die Gene, wie können wir uns über ihre Herrschaft erheben? Um diese entscheidenden Fragen zu beantworten, müssen wir uns ein Gen nach dem anderen vorknöpfen und herausfinden, was es tut.

Das klingt zwar logisch, aber so funktioniert das nicht. Wir alle sind viel mehr als die Summe der Gene in unserem Genom. Wenn die Mitglieder der Gengesellschaft einen menschlichen Körper formen und betreiben wollen, der sie ein paar Jahrzehnte trägt und in die nächste Generation katapultiert, dann müssen sie zusammenarbeiten, in einem engen Geflecht aus Rivalitäten und Partnerschaften.

Adam Smith erkannte vor fast 250 Jahren, dass Märkte ihre Effizienz den eigennützigen Handlungen der einzelnen Individuen verdanken. In ganz ähnlicher Weise verdanken wir das Fortbestehen der Gengesellschaft (und damit der Menschheit) der Zusammenarbeit und Konkurrenz von Genen, die nur nach ihrem eigenen Überleben trachten.

Mithilfe moderner Technologien sammeln wir Kenntnisse über unsere Gene in bislang ungeahntem Ausmaß an. Spannende Details über die Struktur der Gengesellschaft treten dabei zutage. In ihr gibt es betriebsame Arbeiter, so wie Hämoglobin, das Sauerstoff zu den Öfen der Zellen schleppt, oder die Polymerase, ein Eiweiß, das originalgetreue Kopien von anderen Genen anfertigt. Da gibt es Boten wie FGFR3, das Wachstumssignale erkennt und weiterleitet und dessen Fehler eine Fülle genetischer Krankheiten verursachen können. Da gibt es Manager wie FOXP2, das die für Spracherzeugung zuständigen Arbeiter beaufsichtigt, und SOX9, dessen Versagen einen Jungen in einem Mädchenkörper aufwachsen lässt. Da gibt es ganze Armeen von Schmarotzern, so wie die halbe Million LINE1-Elemente, die unser Genom regelrecht zupflastern und sich von der übrigen Gengesellschaft von Generation zu Generation mitschleppen lassen. Und es gibt Gestalten, die dem Rest der Gengesellschaft ausgesprochen gefährlich werden können, so wie manche Versionen des BRCA1-Gens, die einen weiblichen Körper einen Schritt näher in Richtung Brustkrebs bringen.

Der Schlüssel zum Verständnis unseres Genoms liegt in den Strategien unserer Gene. Dieses Buch zeigt, dass wir unser Genom am besten als eine Zweckgemeinschaft egoistischer Gene betrachten. Es ist die Geschichte der Gengesellschaft und ihrer Mitglieder – ihrer Triumphe und Niederlagen, ihrer ewigen Konflikte und Partnerschaften.

PROLOG

Vor fast zwanzig Jahren, lange bevor wir – die beiden Autoren dieses Buches – uns am Europäischen Molekularbiologielabor (EMBL) in Heidelberg kennenlernten, las jeder von uns Das egoistische Gen, ein Buch des Biologen Richard Dawkins aus dem Jahr 1976. Das sollte unser Leben verändern: Als wir das Buch zum ersten Mal in die Hand nahmen, waren wir ein Informatiker und ein Physiker – doch nach der Lektüre war uns klar: Unsere (berufliche) Zukunft liegt in der Evolutionsbiologie.

Dawkins’ Buch beschreibt in überzeugenden und klaren Worten, was alle Lebewesen in ihrem Kern sind: Überlebensmaschinen – »Roboter, blind programmiert zur Erhaltung der selbstsüchtigen Moleküle, die wir Gene nennen«. Diese frappierende Wahrheit ist auch Jahrzehnte nach dem Erscheinen von Das egoistische Gen noch verblüffend. Sie verbirgt sich vor unseren Blicken durch die unvorstellbare Langsamkeit, mit der Evolution in der Natur gewöhnlich voranschleicht. An diese ernüchternde Erkenntnis gewöhnt man sich ähnlich schwer wie an die absurde, statistische Welt der Quantenmechanik, die sich vor uns in der Winzigkeit ihres Wirkungsbereichs versteckt.

Als Dawkins Das egoistische Gen schrieb, hatte die Menschheit noch kein einziges Genom analysiert. Dawkins baute seine Überlegungen auf logischen Argumenten und auf den Erkenntnissen anderer Wissenschaftler auf, deren Arbeiten ihrerseits auf logischen und mathematischen Überlegungen beruhten. Die immer schneller fortschreitende Untersuchung von Tausenden Genomen, die »genomische Revolution«, hat bisher nichts zutage gefördert, was den fundamentalen Erkenntnissen in Dawkins’ Bestseller widersprechen würde.

Die ersten Genome zeigten, welche Gene beim Bau einer Überlebensmaschine zum Einsatz kommen. Die nach und nach hinzukommenden Genome enthüllten verblüffende Ähnlichkeiten, aber auch bemerkenswerte Unterschiede zwischen den Arten. Diese Unterschiede waren der Schlüssel zum Verständnis der Evolution der Gene. Inzwischen kennen wir neben den Genomen von Tausenden verschiedener Tiere, Pflanzen, Pilze und vor allem Bakterien auch die individuellen Genome von Hunderten Menschen.

Wir können biologische Systeme und ihre Evolution nur durch eine ganzheitliche Sichtweise wirklich verstehen – je mehr Genome wir erforscht haben, umso klarer wird diese Erkenntnis. Gene verhalten sich tatsächlich so, als ob sie egoistisch wären, genau wie von Dawkins beschrieben. Aber genau wie wir leben auch Gene nicht für sich allein: Ganz auf sich gestellt hätte kein Gen je überleben können. Um im Spiel des Lebens zu bleiben, mussten Gene eine Überlebensmaschine nach der anderen bauen und betreiben; und das ging nur durch die Zusammenarbeit mit anderen Mitgliedern der Gengesellschaft.

Jedes menschliche Genom enthält einen vollständigen Satz der gleichen Gene. Aber die Versionen eines Gens in verschiedenen Menschen unterscheiden sich durch Mutationen voneinander. Zwischen diesen verschiedenen Repräsentanten desselben Gens tobt ein heftiger Wettbewerb: der Kampf um Marktanteile und die Vorherrschaft in den Genomen zukünftiger Generationen.

Gene sind über ein kompliziertes Geflecht aus Kooperation und Wettbewerb miteinander verbunden. Deshalb verstehen wir unsere Gene am besten, wenn wir sie als Mitglieder einer Gesellschaft betrachten – das ist der Leitgedanke dieses Buches. Das Konzept des egoistischen Gens hat uns den Weg in die Biologie des dritten Jahrtausends geebnet; ab hier kommen wir am besten weiter, indem wir unseren Blick heben und Gengesellschaften als Ganzes ins Auge nehmen. Dawkins war die Bedeutung dieser erweiterten Sichtweise völlig klar, als er Das egoistische Gen schrieb. Ein Kapitel über dieses Thema in Matt Ridleys wunderbarem Buch Die Biologie der Tugend aus dem Jahr 1997 trägt sogar die Überschrift »Die Gesellschaft der Gene«. Aber als diese Bücher erschienen, waren die Beziehungen zwischen Genen noch kaum untersucht, und ein schlüssiges Verständnis der Gengesellschaft war noch nicht greifbar.

Während dieses Buch in erster Linie die Gengesellschaft betrachtet, gibt es nebenher gleichzeitig einen umfassenden Überblick über weite Bereiche der modernen Biologie. Ausgehend von der Evolution einzelner Zellen in unserem Körper zoomen wir schrittweise in Raum und Zeit heraus: über den menschlichen Körper und die gesamte Menschheit zu immer weiter entfernten Verwandten des Menschen, bis wir im letzten Kapitel schließlich beim Ursprung des Lebens ankommen.

Wir haben dieses Buch für ein allgemeines Publikum geschrieben. Es erwartet von seinen Leserinnen und Lesern keine Vorkenntnisse in Biologie oder Genetik – alles Wichtige wird unterwegs erklärt. Das geheime Leben im Menschen betrachtet die Biologie im Licht der Gengesellschaft. Dieser ungewohnte Blickwinkel macht es vielleicht auch für den einen oder anderen wissenschaftlichen Kollegen interessant. Am meisten würde uns freuen, wenn dieses Buch junge Menschen dazu inspirieren könnte, ihre berufliche Neugier auf die Untersuchung von Genomen zu richten, so wie wir beide selbst vor zwanzig Jahren von Das egoistische Gen inspiriert wurden.

Einer unserer Freunde liest bei Romanen immer zuerst das Ende. Wenigstens kennt er dann den Ausgang der Geschichte, falls er sterben sollte, ehe das Buch zu Ende ist. Diese spezielle Begründung erscheint vielleicht überzogen, aber trotzdem möchten wir den Leser über den Verlauf des Buchs nicht unnötig im Dunkeln lassen. Die folgenden Seiten beschreiben deshalb in groben Zügen den Inhalt des Buches und fassen zusammen, wie die Analogie einer Gengesellschaft unserem Nachdenken über das Leben auf die Sprünge helfen kann. Wer die Spannung bis zum Schluss aufrechterhalten möchte, kann natürlich auch gleich zu Kapitel 1 springen!

Wir beginnen mit einem katastrophalen Zusammenbruch der Kooperation zwischen den Mitgliedern der Gengesellschaft. Krebs ist eine Krankheit des Genoms – der sechs Milliarden Buchstaben langen »Enzyklopädie« aus DNA, die die Informationen zum Bau und Betrieb eines Menschen speichert. Gleichzeitig mit der Beschreibung der Krebsentstehung stellt Kapitel 1 die Hauptakteure des Buches vor: die Zellen, deren Vermehrung unseren Körper aufbaut; die Gene, die die Zellen kontrollieren und dabei in vielfältiger Weise zusammenarbeiten; und die Mutationen, die die Buchstabenfolge der Gene verändern und dadurch den Stoff schaffen, aus dem Evolution gemacht wird.

Bevor Krebszellen lebensbedrohlich werden, müssen sich in ihnen mehrere sehr spezielle Mutationen ereignen, die gemeinsam das Zellwachstum weit über das normalerweise zulässige Maß ankurbeln. Unser Körper besitzt eine Reihe von Sicherungsmechanismen gegen unkontrolliertes Zellwachstum, und jeder davon wird bei Krebsbefall von einer oder mehreren Mutationen durchbrochen. Es ist extrem unwahrscheinlich, dass all diese Mutationen gleichzeitig in einer einzigen Zelle passieren. Warum ist Krebs dann trotzdem so weitverbreitet? Der Schlüssel zur Lösung dieses quälenden Rätsels liegt in der Logik der natürlichen Auslese, dem »Motor« der Evolution, den Charles Darwin als Erster vollständig beschrieben hat. Sobald sich eine Zelle auch nur eine der benötigten Mutationen eingehandelt hat, fängt sie an, sich schneller zu teilen als ihre Nachbarzellen. Nach kurzer Zeit ist die Schar ihrer Nachkommen so groß, dass es nicht mehr unwahrscheinlich ist, dass wenigstens eine der Tochterzellen die nächste Mutation erwischt. Auf diese Art fallen die Verteidigungsmechanismen des Körpers wie Dominosteine, einer nach dem anderen. Die Dynamik der Krebsentstehung macht deutlich, dass unser Genom nichts absolut Verlässliches ist – es verändert sich im Laufe unseres Lebens, von Zelle zu Zelle.

Kapitel 2 führt die Idee der Gengesellschaft ein: die Gemeinschaft der vielen verschiedenen Varianten aller Gene, die in menschlichen Genomen leben. Jede Gesellschaft muss ihre Grenzen festlegen und verteidigen, und in der Gengesellschaft übernimmt das Immunsystem diese Aufgabe. Das Immunsystem unterscheidet zwischen den Mitgliedern der Gesellschaft und den Genen von Eindringlingen, die ihr gefährlich werden können. Die Gengesellschaften von Menschen und Bakterien benutzen zwei grundsätzlich verschiedene Strategien für diese Grenzziehung. Beide Immunsysteme beruhen auf dem Vergleich von verdächtigen Genen, die von Eindringlingen stammen könnten, mit im Genom gespeicherten »Fahndungsfotos«. Unser eigenes Immunsystem benutzt dafür das Prinzip der natürlichen Auslese. Bakterien kopieren stattdessen erkennungsdienstliche Informationen direkt vom Eindringling ins eigene Genom – einer der äußerst seltenen Fälle, in denen Information aus der Umgebung direkt ihren Weg ins Genom findet.

Für einen Platz in der nächsten Generation würden Gene töten. Genau das tun manche von ihnen auch: sogenannte Gift/Gegengift-Paare, die beispielsweise in Spermien dafür sorgen, dass alle konkurrierenden Zellen vergiftet werden. In Kapitel 3 sehen wir, wie die Gengesellschaft derlei Betrug so weit wie möglich unterdrückt: Jedes Gen soll die gleiche Chance haben, in die nächste Generation katapultiert zu werden. Diese durch und durch auf Gleichheit angelegte Gesellschaftsstruktur ist nötig, um Sex zu einer erfolgversprechenden Fortpflanzungsstrategie zu machen. Auf den ersten Blick sieht Sex nämlich wie eine ziemlich blöde Idee aus: Anstatt sich selbst einfach zu klonen, geben Mütter ihrem Nachwuchs nur die Hälfte ihrer Gene mit; die andere Hälfte stammt von einem Vater, der häufig kaum etwas anderes beiträgt. Aber auf der in Jahrmillionen gemessenen Zeitskala, auf der sich die Geschichte der Gengesellschaft entfaltet, entpuppt sich Sex als eine brillante Idee: In einer sich ständig wandelnden Welt ist es überlebenswichtig, ständig neue Kombinationen von Genvarianten auszuprobieren. Den Löwenanteil genomischer Neuerungen tragen übrigens Väter bei – dabei handelt es sich um Kopierfehler während der Spermaproduktion, meist mit schädlichen und nur sehr selten mit vorteilhaften Konsequenzen.

Das Schicksal von Genen wird aber nicht nur von der natürlichen Auslese bestimmt, sondern hängt in hohem Maß vom Zufall ab. Das ist das Thema von Kapitel 4. Wir beginnen mit einem Paradoxon: Die Genome zweier beliebiger Menschen sind zu 99,9 Prozent identisch, und trotzdem behandeln Menschen ihr Gegenüber oft beinahe so, als würde es zu einer anderen Tierart gehören. Anhand der winzigen Unterschiede zwischen Menschen aus verschiedenen Regionen können wir nachverfolgen, wie die Menschheit in den vergangenen hunderttausend Jahren von Afrika aus den Rest der Erde besiedelt hat. Einige wenige dieser Unterschiede erzählen auch von der Anpassung an neue Umgebungen oder veränderte Gewohnheiten. Ein Beispiel für den Einfluss von Gewohnheiten auf unser Genom ist die Laktosetoleranz – eine Anpassung an die Haltung von Tieren, die Milch geben. Ein Beispiel für die Anpassung an neue Umgebungen ist unsere Hautfarbe, die ein Gleichgewicht zwischen dem Schutz vor ultravioletter Strahlung einerseits und der Nutzung von Sonnenlicht zur Herstellung von Vitamin D andererseits herstellt. Die meisten Genomunterschiede haben aber keinerlei praktische Konsequenzen; die unterschiedlichen Genversionen sind hier nur passive Mitläufer, oft Trittbrettfahrer von evolutionär erfolgreichen Nachbargenen im Genom. Menschen werden häufig diskriminiert, weil sie als (genetisch) »anders« wahrgenommen werden – die Grundidee des Rassismus. Auch wenn noch niemand ein menschliches Rassismusgen ausgemacht hat, wissen wir von anderen Tieren, dass solche Gene sich dank der natürlichen Auslese leicht ausbreiten können. Aber das darf man nicht falsch verstehen: Diese Gene verfolgen ihre eigenen egoistischen Interessen, selbst wenn das den Interessen ihres Trägers und der Menschheit insgesamt zuwiderläuft.

Die Gengesellschaft besteht aus einem komplizierten Netz von Beziehungen. Die meisten Aufgaben erfordern die Zusammenarbeit mehrerer Gene; gleichzeitig haben die meisten Gene mehr als eine Zuständigkeit. Kapitel 5 beschreibt das Organigramm, das unsere Gene mit ihren Aufgaben verknüpft. Die eine oder andere Krankheit kann auf die Fehlfunktion eines einzelnen Gens zurückgeführt werden; aber typischerweise entstehen Krankheiten durch Reibereien zwischen mehreren Mitgliedern der Gengesellschaft. Auf der anderen Seite führen die parallelen Zuständigkeiten oft dazu, dass verschiedene Mutationen desselben Gens völlig unterschiedliche Symptome verursachen. Diese können so verschieden sein wie eine Geschlechtsumwandlung und eine Fehlbildung des Gesichts. Die komplexen Beziehungen zwischen Genen erstrecken sich weit über die Entstehung von Krankheiten hinaus, und sie beherrschen die Gengesellschaften aller Lebewesen.

Gengesellschaften kennen keinen Stillstand. Wenn eine Barriere – etwa ein neu entstandener Fluss – zwei Teile einer Gesellschaft lange genug daran hindert, sich wieder miteinander zu vermischen, dann entwickeln die Teilgesellschaften sich zwangsläufig auseinander. Irgendwann können die Mitglieder der beiden Gengesellschaften überhaupt nicht mehr zusammenarbeiten: Dann ist eine neue Art entstanden. In Kapitel 6 betrachten wir die Entstehung von Mensch und Schimpanse als eine solche Aufspaltung einer uralten Gesellschaft. An welchem Punkt konnten sich die Gengesellschaften nicht mehr vermischen? Spekulationen über Affenmenschen – Kreuzungen zwischen Mensch und Schimpanse – sind heute nur noch ein Thema für die Boulevardpresse, aber ein genauer Vergleich unserer Genome mit denen von Schimpansen enthüllt tatsächlich solche urzeitlichen Skandale. Ähnlich Skandalöses passierte auch in jüngerer Zeit: Millionen Jahre nach dem letzten echten Affenmenschen begegneten anatomisch moderne Menschen, die sich aus Afrika herausgewagt hatten, den in Asien und Europa heimischen Neandertalern. Obwohl heutige Darstellungen die Neandertaler meist als affenartige Rohlinge porträtieren, muss es eine nicht unbeträchtliche erotische Anziehung zwischen ihnen und den Neuankömmlingen gegeben haben. Intime Begegnungen hinterließen ihre Spuren in unseren Genomen – das Ergebnis hilft uns noch heute, mit den Krankheitserregern Europas und Asiens fertigzuwerden.

Man kann die Gengesellschaft grob in Manager und Arbeiter einteilen. Viele Innovationen entstehen allein durch ein verändertes Management derselben Arbeiter. Kapitel 7 zeigt, dass sich verschiedene Arten tatsächlich oft mehr durch ihr Management als durch ihre Arbeitsgene unterscheiden. Änderungen im Management des Gehirnbaus haben zum Beispiel unser ungewöhnlich großes Gehirn ermöglicht; auch die menschliche Sprache ist eine Folge von verändertem Hirnmanagement. Die obersten Bauleiter unseres Körpers sind die Hox-Gene. Nicht nur in unserem Körper: Die Cousins unserer Hox-Gene beaufsichtigen auch den Bau fast aller anderen Tiere. Ein defektes Hox-Gen kann zum Beispiel einer Fliege Beine auf dem Kopf wachsen lassen. Bakterien haben zwar keine Beine oder Köpfe, aber einige von ihnen können sich in fast unzerstörbare Zeitkapseln umbauen, um schlummernd harte Zeiten zu überstehen. Das Manager-Gen, das diese Verwandlung beaufsichtigt, ist niemand anders als ein weiterer entfernter Cousin unserer Hox-Gene.

Kapitel 8 beschreibt, wie die Gengesellschaft neue Gene rekrutiert: durch die Verdopplung von Genen, deren Kopien neue Funktionen übernehmen können. Diese Strategie ist seit Jahrmilliarden ausgesprochen erfolgreich, sodass unser Genom inzwischen zu einem großen Teil aus abgewandelten Kopien von Kopien von Kopien besteht. Beeindruckende Beispiele für den Erfolg dieser Verdopplungsstrategie liefern unsere Sinnesorgane. Unsere Fähigkeit, Farben zu unterscheiden, beruht auf drei Kopien desselben Gens (jetzt spezialisiert auf rotes, grünes und blaues Licht). Um zahllose verschiedene Gerüche zu unterscheiden, wären drei Kopien viel zu wenig: Unser Geruchssinn beruht auf Hunderten Kopien eines Ursprungsgens. Um ihre Gengesellschaften zu erweitern, können Bakterien auf eine verwandte Strategie zurückgreifen. Sie kopieren Gene aus den Genomen anderer Bakterien – eine Form von intellektuellem Diebstahl. Auf diese Art lernen Bakterien, neue Nahrungsquellen anzuzapfen oder – schneller, als uns lieb ist – sich gegen Antibiotika zu wehren.

Gengesellschaften können sich aufspalten, um neue Arten zu bilden. Aber sie können sich auch vereinigen, mit spektakulären Konsequenzen. In Kapitel 9 sehen wir, dass jede unserer Zellen das Produkt einer Milliarden Jahre alten Verschmelzung zwischen zwei sehr verschiedenen Bakterien ist. Die vereinigte Gengesellschaft dieser symbiotischen Beziehung konnte sich in Richtungen entwickeln, die ihren beiden Elterngesellschaften verwehrt waren. Genau wie bei gelungenen Unternehmenszusammenschlüssen war die Gemeinschaft weit erfolgreicher als jedes Teilunternehmen für sich. Jede unserer Zellen ist also im Prinzip nichts anderes als ein aufgeblähtes Bakterium des einen Typs (ein Archaebakterium), das in seinem Innern etliche Bakterien des anderen Typs (Eubakterien) als Energielieferanten beherbergt. Die meisten Gene dieser Energielieferanten sind inzwischen in das Genom ihres Herbergsvaters umgezogen und arbeiten jetzt von dort aus weiter.

Schmarotzer sind ein unvermeidlicher Teil jeder Gesellschaft. Kapitel 10 zeigt, wie eine unvorstellbare Vielfalt von Trittbrettfahrern seit mehr als vier Milliarden Jahren überlebt, indem sie die übrigen Mitglieder der Gengesellschaften, die fleißig eine Überlebensmaschine nach der anderen bauen, ausnutzen. Eine Konsequenz dieses Schmarotzertums ist die maßlos übertriebene Größe unseres Genoms. Das menschliche Genom ist zugepflastert mit Genen, die nichts anderes können, als Kopien von sich selbst zu machen und diese wieder ins Genom einzufügen. Diese Art von genomischen Parasiten ist nicht auf den Menschen beschränkt: Das Genom der bescheidenen Zwiebel ist dadurch sogar noch fünfmal größer als unseres! Die Vorväter der Viren – die Könige der Schmarotzer – mischten sich vermutlich schon unter die allerersten einfachen organischen Moleküle, die sich vor vier Milliarden Jahren in Felsbläschen rund um heiße Quellen auf dem Grund des Meeres versammelten.

So weit die Kurzfassung für ganz Eilige – viel spannender wird es, wenn wir in die Details eintauchen.

Kap-01

IN ACHT EINFACHEN SCHRITTEN ZUM KREBS

»Mit großer Macht geht
große Verantwortung einher.«

Voltaire

Bob Marleys Reggae inspirierte Millionen. Doch seine Karriere fand ein tragisches, vorzeitiges Ende, als er mit sechsunddreißig an den Folgen einer Hautkrebserkrankung starb. Der Krebs hatte vier Jahre zuvor begonnen, scheinbar harmlos – als kleiner Fleck unter einem Zehennagel, den Marley einer Fußballverletzung zuschrieb. Als seine Ärzte auf einer Amputation des Zehs bestanden, stellte Marley sich quer: Seine Rastafari-Auslegung eines Verses aus dem 3. Buch Mose (»Ihr dürft euch nicht … Einschnitte an eurem Leibe machen«) verbiete einen solchen Eingriff. Der Tumor breitete sich ungebremst in seinem Körper aus, angetrieben von der zwingenden Logik der natürlichen Auslese. Marley hätte den Tumor vielleicht rechtzeitig entfernen lassen, wenn er verstanden hätte, wie Evolution in unserem Körper Krebszellen entstehen lässt. Womöglich hätte er sogar seinen Einzug in die Rock and Roll Hall of Fame im Jahr 1994 noch persönlich erlebt.

Krebs ist die vielleicht schrecklichste aller Volkskrankheiten; ganz sicher ist es die am schwersten zu vermeidende und zu behandelnde. Während moderne Medikamente viele andere Krankheiten überwinden können, tut sich die Pharmaindustrie im Umgang mit Krebs enorm schwer. Warum ist der Verursacher von Krebs so schwer zu packen?

Krebs ist kein Angriff auf den Körper von außen. Krebs ist auch kein schrecklicher Unfall im Körper des Betroffenen. Krebs ist eine Machtdemonstration der Evolution. Die Krebsentstehung folgt einer unausweichlichen Logik – sie beruht auf denselben Prinzipien, die die Evolution von Tieren und Pflanzen vorantreiben. Als Auftakt zur Geschichte der Gengesellschaft machen wir Bekanntschaft mit Zellen, mit Genen und mit der Evolution, immer aus dem Blickwinkel der Krebsentstehung.

Krebsgeschwüre sind ein Teil von uns, sie sind ein natürlicher (wenn auch zum Glück nicht normaler) Bestandteil unseres Körpers. Genau das macht ihre Verhütung und Behandlung so schwierig. Wir können den menschlichen Körper als ein Gebäude betrachten, das aus Billionen (das heißt aus Millionen Millionen) Bausteinen, den Zellen, besteht. Zellen tauschen Nährstoffe und chemische Signale aus. Jede Zelle arbeitet wie eine kleine Fabrik. Verschiedene Zellen sind auf unterschiedliche Aufgaben spezialisiert, die zum Gelingen des Gesamtprojekts – dem Bau und Betrieb der Überlebensmaschine Körper – beitragen. In Krebspatienten verweigert sich eine Gruppe von Zellen der Zusammenarbeit mit dem Rest des Körpers und beginnt stattdessen, sich auf Kosten der anderen unkontrolliert zu vermehren.

Neue Zellen entstehen ausschließlich durch die Teilung einer bestehenden Zelle, der Mutterzelle, in zwei Tochterzellen. Deshalb können wir alle Zellen unseres Körpers auf einem gigantischen Stammbaum anordnen, der Mutterzellen mit Tochterzellen verbindet. Die Wurzel dieses Stammbaums ist die einsame befruchtete Eizelle, die den Anfang unseres Lebens markiert. Ein Stammbaum mit Billionen Ästen passt auf kein Blatt Papier; deshalb illustriert Abbildung 1.1 das Stammbaumprinzip für Zellen am Beispiel eines viel einfacheren Tieres, als wir es sind: eines Fadenwurms.

3164-057.ai

Abb. 1.1: Der Zellstammbaum des winzigen Fadenwurms Caenorhabditis elegans. In nur dreizehn Stunden entwickelt sich aus einer einzigen befruchteten Eizelle (oben) ein einfaches Tierchen mit genau 558 Zellen (unten). Die Mitte zeigt den sich entwickelnden Embryo; Kreise stellen einzelne Zellen dar. Jede senkrechte Linie entspricht einer sich entwickelnden Zelle, jede waagerechte Linie markiert eine Zellteilung. Gruppen von Zellen spezialisieren sich auf die Konstruktion einzelner Organe, wie den Rachen oder Nerven. Menschliche Zellstammbäume sehen prinzipiell genauso aus – nur sehr, sehr viel größer.

Aus einer befruchteten Eizelle entwickelt sich ein kompletter Mensch, ohne dass es dazu einen Bauleiter oder Architekten braucht. Die nach und nach entstehenden Zellen teilen sich die Verantwortung für die nötige Koordination. Das ist, als würden jeder Stein, jedes Kabel und jedes Rohr eines Wolkenkratzers über die Pläne für das komplette Gebäude verfügen und jeweils mit ihren Nachbarn beraten, wo sie sich am besten hinplatzieren.

Auch Krebs ist ein Ast im Zellstammbaum eines Patienten, eine wuchernde Masse seiner eigenen Zellen. Jedes Krebsgeschwür beginnt als die Spitze eines winzigen Zweiges, als eine einzige Zelle. Die Zelle und ihre Nachkommen teilen sich immer weiter, weit über den Punkt hinaus, an dem sie längst hätten aufhören sollen. Die Krebszellen überwuchern so den Körper. Sie werden schließlich so zahlreich und verbrauchen so viel Nährstoffe, dass andere Organe ausgehungert zusammenbrechen – das katastrophale Ende der Arbeitsteilung zwischen den Zellen.

Woher wissen unsere Zellen, wann sie sich teilen sollen und wann nicht? Zellteilung ist ein komplizierter Prozess, der genau orchestriert werden muss. Wenn auch nur die Hälfte der Zellen in unserem Gesicht oder unserer Hand sich einmal zu viel geteilt hätte, dann hätten wir entfernte Ähnlichkeit mit Joseph Merrick, der im 19. Jahrhundert sein Brot damit verdiente, dass er sich selbst als den »Elefantenmenschen« zur Schau stellte.

Solche unerwünschten Zellteilungen werden normalerweise durch eine Art Demokratie im Zaum gehalten: Zellen wachsen und teilen sich nur dann, wenn ihre Nachbarzellen sie dazu auffordern. Dazu kommunizieren die Zellen durch Wachstumsfaktoren, spezielle Botenstoffe, die im Zellinneren produziert und dann von der Zelle abgesondert werden. Eine Zelle teilt sich nur dann, wenn sie entsprechende Signale von genügend Nachbarn gleichzeitig erhält. Diese Aufsummierung von Signalen ist ein Sicherheitsmechanismus, um den Körper vor den Fehlentscheidungen einzelner Zellen zu schützen.

Eine Erkrankung des Genoms

Krebszellen sind anders als andere Zellen. Sie vervielfältigen sich ohne Rücksicht auf das, was ihre Nachbarn sagen. Was macht sie so anders? Im Herzen einer jeden Zelle, egal bei welchem Lebewesen, sitzt das Genom. Man kann jedes menschliche Genom als einen Text aus sechs Milliarden Buchstaben betrachten, etwa dreihundertmal so viele wie in Goethes gesammelten Werken. Diese Buchstaben verteilen sich auf sechsundvierzig Bände, die Chromosomen. Dabei bringt unser Genom seine eigene Sicherungskopie mit: Je zwei der sechsundvierzig Bände sind – bis auf ein paar »Druckfehler« – miteinander identisch. Dabei gibt es nur eine einzige Ausnahme: die ungepaarten Geschlechtschromosomen von Männern, X und Y (Frauen haben auch hier ein Paar, zweimal X).

Der Genomtext ist in einem Alphabet aus nur vier Buchstaben geschrieben: A, T, C und G – die Abkürzungen für vier als Nukleobasen (oder schlicht Basen) bezeichnete Moleküle: Adenin, Thymin, Cytosin und Guanin. Zur Bildung eines Chromosoms werden Millionen solcher Basen zu einer Kette verknüpft. Dadurch entsteht ein riesiges Molekül namens Desoxyribonukleinsäure – nach der englischen Schreibweise (deoxyribonucleic acid) üblicherweise abgekürzt als DNA.

3164-056.ai

Abb. 1.2: Ein Chromosom ist ein gigantisches Molekül aus Millionen Basen (die vier »Buchstaben« A, T, C und G), die zu zwei komplementären Ketten (oder »Strängen«) verbunden sind. Chromosomen verändern im Lebenszyklus einer Zelle ihre Form. Der oberste Teil der Abbildung zeigt ein Chromosom in seiner kompaktesten Form, in der die Doppelketten eng zusammengeknäult sind. Darunter ist ein kleiner Abschnitt des Chromosoms in zunehmender Vergrößerung dargestellt. Der unterste Teil zeigt die beiden sich ergänzenden Ketten: Dabei paart A sich immer mit T, C immer mit G.

Chromosomen bestehen aus zwei parallelen, eng miteinander verknüpften DNA-Ketten (Abb. 1.2). Die Ketten sind »komplementäre Spiegelbilder«: Sie ergänzen sich gegenseitig, jedes A in der einen Kette ist mit einem T in der anderen Kette verbunden, und jedes C ist mit einem G gepaart. Wenn wir die im Genom gespeicherte Information als eine Abfolge von Buchstaben beschreiben, genügt es deshalb, nur eine der beiden Ketten zu betrachten. Die andere Kette können wir anhand der Regeln für die komplementären Spiegelbilder einfach dazukonstruieren.

Um eine Vorstellung von unserem Genomtext zu bekommen, betrachten wir einmal dieses winzige Bruchstück von Chromosom 9:

…ACCAGTTCTCCATGATGTGAATTTTCCATGTATGACTGAACCACAATATCTCAGGG ACCCCATAAATAT…

Dieser Abschnitt ist für sich genommen nicht sehr informativ. Wir sind noch sehr weit davon entfernt, jeden einzelnen Buchstaben in diesem viele Millionen Jahre alten Text deuten zu können. Kein Genom wurde jemals vollständig entschlüsselt: Wir mögen alle Buchstaben gelesen haben, aber wir haben häufig schlicht keine Ahnung, was sie bedeuten.

Texte in einer beliebigen Sprache können in Absätze unterteilt werden, die mehr oder weniger zusammenhängende Gedanken verkörpern. Auf ganz ähnliche Weise können wir ein beliebiges Genom in separate Abschnitte aufteilen, die sogenannten Gene. Die bedeutendsten Gene sind präzise, bauplanartige Beschreibungen für die Konstruktion von Eiweißen (Proteinen); davon hat jeder von uns etwa 20 000. Eiweiße führen die meisten Arbeiten in einer Zelle aus, und ihre Gene sind die Protagonisten dieses Buches.

Die Buchstabenfolge jedes dieser Gene besteht aus zwei Teilen (Abb. 1.3): einem Bauplan, der den Aufbau des Eiweißes beschreibt, und einem Abschnitt mit molekularen Schaltern. Diese Schalter regeln die Aktivität eines Gens: Sie kontrollieren, ob und mit welchem Tempo der Bauplan in Vorlagen für die Eiweißproduktion kopiert wird. Die meisten Gene haben mehrere solcher Schalter. Ein Gen enthält also nicht nur einen Bauplan für ein Eiweiß, sondern auch die nötigen Schalter, um bei Bedarf seine Produktion zu steigern oder zu drosseln – auf diese wichtige Tatsache werden wir noch mehrmals zurückkommen.

3164-055.ai

Abb. 1.3: Ein eiweißkodierendes Gen besteht aus dem Bauplan, der in Vorlagen für die Eiweißproduktion kopiert wird, sowie aus molekularen Schaltern, mit denen die Produktion des Eiweißes gesteigert oder gedrosselt werden kann.

Die wichtigste Aufgabe beim Vermehren von Zellen ist das Kopieren der Chromosomen. Dafür ist eine winzige Maschine zuständig, die DNA-Polymerase. Sie wird aus Dutzenden von Eiweißen zusammengesetzt, aber ihre Funktion ist einfach: Sie zieht die beiden DNA-Ketten des Chromosoms auseinander und ergänzt jede Hälfte wieder mit den fehlenden Buchstaben.

Ein Chromosom kann beschädigt werden oder sogar komplett auseinanderbrechen. Ein Chromosomenschaden ist eine chemische Veränderung des DNA-Moleküls, so wie Rost eine chemische Veränderung von Eisenatomen ist. Rost kann man leicht von normalem Eisen unterscheiden; es gibt sogar Rostumwandler, die Rost in einen Schutzfilm umwandeln. Viele Arten von Chromosomenschäden sind ähnlich leicht zu finden und zu reparieren wie Rost. Aber es gibt andere Beschädigungen, die nicht so leicht zu entdecken sind, etwa, wenn einer der DNA-Buchstaben durch einen der anderen drei Buchstaben ersetzt wird. Entsprechend häufig übersehen die für die Fehlerkontrolle verantwortlichen Eiweiße solche Schäden. Nicht korrigierte Fehler können sich im Genom als Mutationen festsetzen.

Hier ist ein Beispiel für eine Mutation der Buchstabenfolge von oben:

Vor der Mutation: …ACCAGTTCTCCATGATGTGAATTTT…
Nach der Mutation: …ACCAGCTCTCCATGATGTGAATTTT…

An der sechsten Position wurde ein T durch ein C ausgetauscht. Eine so kleine Änderung sieht unbedeutend aus, aber ein einziger Druckfehler kann die Bedeutung eines Textes drastisch verändern, wie dieses Beispiel zeigt:

Vor der Mutation: …EIGENER HERD IST GOLDES WERT…
Nach der Mutation: …EIGENER HELD IST GOLDES WERT…

Ein geschlagenes Prozent unserer Gene ist mit dem Korrekturlesen und der Reparatur von Chromosomen beschäftigt. Trotz dieses beträchtlichen Aufwands bei der Fehlerkorrektur ist das Kopieren von DNA nicht perfekt. Bei einer Zellteilung muss jeder einzelne Buchstabe im Genom kopiert, geprüft und – falls nötig – berichtigt werden. Dass dabei versehentlich ein bestimmtes Buchstabenpaar verändert wird, ist extrem unwahrscheinlich: Die Chancen dafür stehen etwa eins zu zehn Milliarden. Aber unser Genom hat ja sechs Milliarden Buchstabenpaare! Die Wahrscheinlichkeit, dass wenigstens eines davon in einer Kopierrunde versehentlich ausgetauscht wird, liegt also bei 60 Prozent. Und 60 Prozent sind noch optimistisch: Sie gelten nur, wenn wir ein gesundes Leben führen. Giftige Chemikalien, wie sie in Zigarettenrauch oder verbranntem Fleisch vorkommen, und UV-Strahlung von Sonne oder Solarien können zu weit höheren Mutationsraten führen.

Nicht alle Mutationen bestehen aus dem Ersetzen eines einzelnen Buchstabens durch einen anderen. Komplette Abschnitte von Buchstaben können entweder verloren gehen oder aber an eine andere Stelle des Genoms kopiert werden. Weil bei fast jeder Zellteilung neue Mutationen dazukommen, hat jeder von uns nicht nur ein Genom. Wir haben viele Milliarden davon: Jede einzelne unserer Zellen hat ihr eigenes.

Die Mutationen addieren sich von Zellteilung zu Zellteilung weiter auf. Eine ähnliche allmähliche Anhäufung von Veränderungen gab es in der handschriftlichen Buchherstellung im Mittelalter. Jedes Mal, wenn ein Buch abgeschrieben wurde, schlichen sich ein paar neue Fehler ein; mit der Zeit nahmen manche Passagen dadurch eine komplett neue Bedeutung an. Genauso haben Genome, die häufiger kopiert wurden, zwangsläufig mehr Fehler angesammelt. Das Problem wird noch dadurch verschlimmert, dass Mutationen manchmal auch Gene kaputt machen, die selbst bei der Fehlerkorrektur mithelfen. Dann werden später auftretende Fehler nicht mehr richtig repariert, und die Ansammlung von Mutationen beschleunigt sich massiv.

Die meisten Mutationen haben keine merklichen Konsequenzen, genauso wie die meisten Leser die Bedeutung des Beispielsatzes oben auch dann noch problemlos verstehen würden, wenn es »AIGENER HERD …« lauten würde. Aber manchmal bewirkt die Mutation eines unserer Gene eine sichtbare Veränderung. Ein besonders auffälliges Beispiel bieten Menschen mit zwei verschiedenfarbigen Augen, verursacht durch eine Mutation, die die Pigmente in einer Iris verändert. Ein anderes, häufig auftretendes Beispiel sind Muttermale, verursacht durch Mutationen in Hautzellen.

Wenn eine Mutation das Genom einer bestimmten Zelle verändert, wie kann dann die komplette Iris eines Auges oder ein ganzer Hautfleck gleichzeitig betroffen sein – beide bestehen doch aus Millionen von Zellen, jede mit ihrem eigenen Genom? Wenn uns ein Mädchen mit einem braunen und einem blauen Auge über den Weg läuft, ist dann die gleiche Mutation zufällig in jeder einzelnen Zelle der einen Iris passiert? Natürlich nicht. Die Erklärung liegt im Stammbaum der Zellen: Wenn die Mutation in der ersten Zelle der sich entwickelnden Iris aufgetreten ist, dann erben alle Tochterzellen in dieser Iris die entsprechende Veränderung (Abb. 1.4).

3164-054.ai

Abb. 1.4: Der Stammbaum der Zellen einer sich entwickelnden Iris. Eine Mutation in der mit dem Pfeil gekennzeichneten Zelle zerstört das Gen für das braune Pigment, sodass alle Tochterzellen heller sind – ein Sektor der Iris (oder, wenn die Mutation noch früher passiert, die ganze Iris) erscheint deshalb blau.

Alle Zellen in einem Fleck, der sich durch Mutationen von seiner Umgebung unterscheidet, können ihren Stammbaum bis zu derselben mutierten Zelle zurückverfolgen. Jede Zelle des Flecks hat dieselbe farbverändernde Mutation von dieser Vorfahrin geerbt. Deshalb nehmen alle gemeinsam eine neue Farbe an, die sie von den nicht-mutierten Nachbarn (oder ihren nichtmutierten Gegenstücken im anderen Auge) unterscheidet. Ein weiteres Beispiel für diesen Vorgang sind Feuermale: Wenn während der Entwicklung eines Blutgefäßes eine bestimmte Mutation in einer Zelle passiert, werden alle aus dieser Zelle und ihren Nachkommen entstehenden Blutgefäße dicker und färben die umgebende Haut dunkelrot.

Ein Großteil unserer Genomkopien wurde schon im Mutterleib angefertigt. Aber viele Zellen werden im Laufe unseres Lebens ständig erneuert: Hautzellen zum Beispiel werden monatlich durch frische ersetzt. Mutationen, die das Gleichgewicht der Hautpigmente durcheinanderbringen, werden deshalb mit zunehmendem Alter (also nach mehr und mehr Kopierrunden) wahrscheinlicher. So entstehen Altersflecken.

Die Genome von Krebszellen enthalten Mutationen mit weit schwerwiegenderen Konsequenzen als Muttermale oder verschiedenfarbige Augen. In einem Experiment an Mäusezellen wurde zum ersten Mal eine für Krebs besonders wichtige Mutation entdeckt. Unter bestimmten Umständen können Zellen so verändert werden, dass sie außerhalb des Körpers in einer Nährflüssigkeit überleben. Damit die Zellen sich teilen können, müssen der Nährflüssigkeit Wachstumsfaktoren zugesetzt werden – die Botenstoffe für das Zellwachstum, die normalerweise von den Nachbarzellen abgesondert werden. Solche isoliert wachsenden Zellhaufen, an denen man untersuchen kann, wie unsere Zellen im Detail funktionieren, nennt man Zelllinien. Zelllinien unterscheiden sich von Krebsgeschwüren durch ihre Abhängigkeit von Wachstumsfaktoren. Aber eine einzige Mutation kann genügen, um diesen Unterschied zu beseitigen: ein G anstelle eines T an einer ganz bestimmten Position in einem Gen namens H-Ras. Diese Entdeckung war ein entscheidender Durchbruch. Sie zeigte, dass die fehlgeleiteten Anweisungen eines einzigen mutierten Gens ausreichen, um aus einer normalen Zelle eine Krebszelle zu machen.

H-Ras ist Teil eines Antwortsystems, das auf die Wachstumsfaktoren reagiert, die von benachbarten Zellen ausgeschieden werden. Das von H-Ras beschriebene Eiweiß arbeitet als Bote. Wenn es durch eine gezielte chemische Veränderung in seinen aktiven Zustand versetzt wird, aktiviert es seinerseits andere Eiweiße, die dann den Rest der Zelle informieren, dass die Zeit zum Wachsen gekommen ist. Das H-Ras-Eiweiß ist normalerweise nur dann aktiv, wenn die Zelle die entsprechenden Wachstumsfaktoren bekommt. Aber die Mutation versetzt das Eiweiß in einen Zustand unablässiger Aktivität. Als Folge teilt sich die Zelle immer weiter, ganz egal, ob die benachbarten Zellen sie dazu auffordern oder nicht. H-Ras ist ein ganz normaler Bürger der Gengesellschaft, der eine sehr wichtige Aufgabe erfüllt – doch eine einzige Mutation macht aus ihm ein Onkogen, also ein Krebsgen.

Um schlimme Konsequenzen solcher Mutationen zu verhindern, ist in unser Genom eine Grenze für die maximale Anzahl von aufeinanderfolgenden Zellteilungen eingeschrieben; aber diese Grenze kann durchbrochen werden. Zelllinien umgehen diese Grenze, und das ist einer der Gründe, warum eine einzige Mutation von H-Ras ausreicht, um eine Zelllinie in ein Krebsgeschwür zu verwandeln. Wie genau funktioniert dieses Sicherungssystem, und wie kann es umgangen werden?

An beiden Enden unserer Chromosomen sind Verdoppelungszähler angebracht, sodass die Zelle jederzeit einen groben Überblick darüber hat, wie oft sie sich schon geteilt hat. Die Chromosomenenden heißen Telomere (griechisch für Endstücke). Sie bestehen aus einer festen Abfolge von Buchstaben, TTAGGG, tausendfach wiederholt:

…TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG…

Bei jedem Kopiervorgang werden die Telomere um etliche Wiederholungen verkürzt. Das ist eine simple Folge der Kopiertechnik: Ein Stück am Ende des Chromosoms wird nicht mitkopiert. Es ist so, als hätte jedes Chromosom der befruchteten Eizelle ein Fahrscheinheft mitbekommen, von dem bei jeder Zellteilung ein Abschnitt abgerissen wird. Nach ein paar Dutzend Runden ist das Heft leer, und die Zelle kann das Chromosom nicht weiter kopieren.

Menschliche Zellen sind darauf programmiert, sich das Leben zu nehmen, wenn ihre Telomere abgenutzt sind. Und das ist gut so: Abgewetzte Telomere sind ein Zeichen ungebremsten Wachstums. Der Selbstmord der Zelle schützt den Rest des Körpers vor den Gefahren eines Krebsgeschwürs. Eine Krebszelle muss dieses Selbstmordprogramm umgehen, indem sie abgenutzte Telomere wieder aufbaut. Die Lösung hierfür ist erschreckend einfach. Krebszellen bedienen sich der Hilfe einer molekularen Maschine namens Telomerase, einem Gebilde aus etlichen Eiweißen. Die entsprechenden Gene verteilen sich über mehrere Chromosomen und sind auf eine einzige Aufgabe spezialisiert: den Wiederaufbau von Telomeren (Abb. 1.5).